Using DNA similarities -Model answers (Activity 2)
Species A: CATCATCATCATCATCATCATCATCATCAT Species B: CATCATTACTACTACTACCATCATCATCAT Species C: CATCATTACTACTACTACCATCATTATCAT In the DNA of these species there looks to have been two mutations. Of course both of these mutations could have happened in reverse. TAC could have become CAT and T could have become C. Is it possible to identify which base sequence came first? The quick answer: Using a cladogram, yes,it is...