You need to log-in or subscribe in order to use Student access.

Using DNA similarities -Model answers (Activity 2)

Species A: CATCATCATCATCATCATCATCATCATCATSpecies B: CATCATTACTACTACTACCATCATCATCATSpecies C: CATCATTACTACTACTACCATCATTATCATIn the DNA of these species there looks to have been two mutations. Of course both of these mutations could have happened in reverse. TAC could have become CAT and T could have become C. Is it possible to identify which base sequence came first?The quick answer: Using a cladogram, yes,it is possible...

To access the contents of this site, you must subscribe.

Help